Download Test II Solutions for Biochemistry | CHEM 642 and more Exams Biochemistry in PDF only on Docsity!
(I) Fill in the blanks (20%)
- In eucaryotic cells the RNA molecule produced by transcription alone would contain
both coding called exons_, and noncoding, called introns, sequences. Before it can be
translated into protein, the two ends of the RNA are modified, the noncoding sequences
are removed by an enzymatically catalyzed splicing reaction, and the resulting
mRNA is transported from the nucleus to the cytoplasma.
- The group I intron sequences bind a free G nucleotide to a specific site on the RNA to
initiate splicing, while the group II intron sequences use an especially reactive A_
nucleotide in the intron sequence itself for the same purpose.
- There are 5 stages of protein synthesis: At first, aminoacyl-tRNA synthetase attach
the correct amino acids to their tRNAs. Then, a _Met amino acid initiates protein
synthesis. Unlike eucaryotic ribosomes, which typically require a capped 5'end,
procaryotic ribosomes initiate transcription at ribosome-binding sites called
Shine-Dalgarno, which can be located anywhere along an mRNA molecule.
- There are many DNA damage types that require different repair pathways. Show each
of the following enzymes involved in what repair pathway. (a) AP endonuclease BER (b) mutS-mutL complex MMR
(c) ABC excinuclease NER
(d) DNA photolyase Direct reversal
- The current view of protein folding suggests each domain of a newly synthesized
protein rapidly attains a “Molten Globule” state. Subsequent folding occurs more
slowly and by multiple pathways, often involving the help of a _chaperone.
Some molecules may still fail to fold correctly; these are recognized and degraded
by_proteasome_.
- Match the following list of RNAs with their functions. A. mRNA 3 1. adaptor for protein synthesis B. rRNA 4 2. chemical modification of other RNAs C. snoRNA 2 3. codes for proteins D. snRNA 5 4. components of ribosome E. tRNA 1 5. splicing of RNA transcripts
(II) Pick “one” correct answer from each question (12%)
- Which of the following are features of the wobble hypothesis?
A) A naturally occurring tRNA exists in yeast that can read both arginine and lysine codons. B) A tRNA can recognize only one codon. C) Some tRNAs can recognize codons that specify two different amino acids, if both are nonpolar. D) The “wobble” occurs only in the first base of the anticodon. E) The third base in a codon always forms a normal Watson-Crick base pair. D
- Which one of the following is true about the genetic code?
A) All codons recognized by a given tRNA encode different amino acids. B) It is absolutely identical in all living things. C) Several different codons may encode the same amino acid. D) The base in the middle position of the tRNA anticodon sometimes permits “wobble” base pairing with 2 or 3 different codons. E) The first position of the tRNA anticodon is always adenosine.
C
- Which of the following statements about tRNA molecules is false?
A) A, C, G, and U are the only bases present in the molecule. B) Although composed of a single strand of RNA, each molecule contains several short, double-helical regions. C) Any given tRNA will accept only one specific amino acid. D) The amino acid attachment is always to an A nucleotide at the 3 ' end of the molecule. E) There is at least one tRNA for each of the 20 amino acids.
A,
- Aminoacyl-tRNA synthetases (amino acid activating enzymes):
A) “recognize” specific tRNA molecules and specific amino acids. B) in conjunction with another enzyme attach the amino acid to the tRNA. C) interact directly with free ribosomes. D) occur in multiple forms for each amino acid. E) require GTP to activate the amino acid.
A
- (A) Describe the dideoxy sequencing reaction (4%).
(B) A duplex DNA to be sequenced is shown below. If the primer you decided to use for
the sequence reaction is 5’ACGATTGC3’. Please draw an imaginary sequencing gel that
shows the expected results of the following 4 reactions with different nucleotide mixtures
(6%):
- dATP, dCTP, dTTP, dGTP, ddTTP
- dATP, dCTP, dTTP, dGTP, ddGTP
- dATP, dTTP, dGTP, ddTTP
- dATP, dCTP, dTTP, dGTP
5’ATTCGCGGTTAAGCGCTTAGGATGGCATCGTATGCAATCGT3’
3’TAAGCGCCAATTCGCGAATCCTACCGTAGCATACGTTAGCA5’
- Descript the functions of EF-Tu, EF-Ts and EF-G? (5%).
- Ribosomes are isolated from bacterial cells which were grown in heavy isotopes medium. Another set of ribosomes are isolated from a medium that containing only the light isotopes. Both fractions are used in an in vitro translation assay. After many rounds of translation have taken place, the ribosome were again isolated and analyzed by centrifugation in a density gradient. How many different bands would be observed for the existing ribosomes? Why? (5%)
Four,
- (10 %) One strand of a section of DNA isolated from E. coli reads 5'-GTATCCCATAAGTAGG-3'
A. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA?
5’-GUA, UCC, CAU, AAG,UAG, G-3’
B. What peptide would be made if translation started exactly at the 5' end of this mRNA? (Assume no start codon is required, as is true under certain test tube conditions.)
Val-Ser-His-Lys-STOP
polymers of RNA containing known ratios of nucleotides (e.g., 70% A and 30% T) generate only certain codons in predictable ratios. The identities and ratios of the amino acids specified by such polymers provided important clues that helped solve the genetic code. (2) Trinucleotides of known sequence were used to stimulate aminoacyl-tRNA binding to ribosomes. Because only that aminoacyl-tRNA whose anticodon matched the trinucleotide “mRNA” was bound, the coding specificity of each sequence of three bases could be determined by determining which of the 20 aminoacyl-tRNAs bound. (3) Additional assignments were made possible using synthetic oligonucleotides containing repeats of specific two, three, or four base pair sequences.
- (6%) The following sequence of four amino acids occurred in the structure of a polypeptide found in a wild-type organism: Leu-Ser-Ile-Arg. Several mutants were isolated, each of which carried a single base pair change in the region of DNA that coded for this amino acid sequence. Their corresponding amino acid sequences are:
Mutant 1 MET-Ser-Ile-Arg 2 Leu-TRP-Ile-Arg 3 Leu-Ser-ARG-Arg 4 Leu-Ser-Ile-PRO 5 Leu-Ser-Ile-TRP
What was the nucleotide sequence of the region of mRNA that coded for the amino acid sequence in the wild-type organism? (Refer to Fig. in 6)
U(A)UG, UC(G)G, CU(G)A, C(U)G(C)G
- (4%)Which of the following mutational changes would you predict to be most deleterious to gene function? Explain your answer.
- Insertion of a single nucleotide near the end of the coding sequence.
- Removal of a single nucleotide near the beginning of the coding sequence.
- Deletion of three consecutive nucleotides in the middle of the coding sequence.
- Deletion of four consecutive nucleotides in the middle of the coding sequence.
- Substitution of one nucleotide for another in the middle of the coding sequence.
2 or 4
- (8%) “Footprinting” or DNase protection is a technique used to identify the specific binding site of a repressor, polymerase, or other regulatory proteins. Describe how this reaction works. The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5 ' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X. (8)
*(5 ' )GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC
*(5 ' )GGATTCTAATAAAGT|AACGCGTT|ACGACTTGG CCTAAGATTATTTCA|TTGCGCAA|TGCTGAACC binding site
- (41. (5%) Match the following list of RNAs with their functions. A. mRNA 3 1. adaptor for protein synthesis B. rRNA 4 2. chemical modification of other RNAs C. snoRNA 2 3. codes for proteins D. snRNA 5 4. components of ribosome E. tRNA 1 5. splicing of RNA transcripts %) Below, an RNA molecule is being transcribed from a strand of DNA. Indicate the 5 ' and 3 ' ends of the RNA molecule and of the strand of DNA that is complementary to the RNA molecule. In which direction is synthesis occurring?
