ICA: Primer Design
(submit one per student)
Be sure to type your response in red text.
You should save your work as PDF and submit as such on via MOODLE turn it in.
You can source for information online.
1. Insert a screenshot of the circular pBDC plasmids with primers from today’s activity (PROTOCOL: Primer Design
step 19):
2. Write out the primer information for your gene cloned into the pBDC plasmid (PROTOOL: Primer Design step 17)
Forward primer (insert name and sequence): ATGGTCAACAAACAGTATTCG
Base pair: 21BP
Melting temperature (Tm): 53 C
GC %: 38%
Reverse primer (insert name and sequence): ACTGGGCAGTCGCTTGCTG
Base pair: 19 BP
Melting temperature (Tm):62 C
GC %:63 %
3. Insert a screenshot of the circular pOBD plasmid with primers annotated from today’s activity (PROTOCOL:
Primer Design step 37):
