Download Bio 310 Midterm I, Winter ‘16 Exam - Prof. Steve Alas and more Exams Cellular and Molecular Biology in PDF only on Docsity!
Bio 310 Midterm I, Winter ‘1 6 (Dr. Steve Alas)
NAME:_________________________________
(last) (first) INSTRUCTIONS
- This exam is 5 pages long, QUESTION VALUE including one extra credit page. Before starting, make sure you have all the pages. 1 10
- No credit will be given for an illegible 2 8 answer. Answers must be clear. I will not interpret vague responses. 3 8
- Partial credit will be given. 4 10
- You have enough space provided to answer 5 10 each question. Please be as brief as completeness allows. 6 18 7 18 8 18 Total 100 Extra Credit 9 8
Key
Part I: Definitions
(10 points) 1. For each of the terms in the left column, choose the best matching phrase in the right column. Place the matching number in the space provided, left of the letter. 10 a. carbohydrate 1. Non-covalent linkage that contributes to protein folding 19 b. squelching 2. mechanism by which a single gene can encode multiple proteins 15 c. motif 3. enzyme that adds phosphate groups to proteins 4 d. exocytosis 4. Process by which most molecules are secreted from a cell 8 e. RNA polymerase I 5. A type of protein that acts as a transcription factor or DNA binding domain 16 f. enhancer 6. displays pieces of proteins produced inside the cell 20 g. ribosomal small subunit 7. system for targeting proteins for degradation 2 h. alternative splicing 8. synthesizes ribosomal RNA (rRNA) 5 i. zinc finger 9. formed by multiple units of ribosomes 13 j. anticodon 10. general term for sugars or sugar complex 18 k. methyl transferase 11. synthesizes messenger RNA (mRNA) 9 l. polysome 12. Ribonucleoprotein that binds an ER signal sequence and directs the polypeptide and its ribosome to the ER 11 m. RNA polymerase II 13. nucleotide bases on the tRNA that interact with mRNA 1 n. ionic bond 14. one type of enzyme responsible for chromatin decondensation 17 o. disulphide bond 15. Simple combinations of secondary protein structures 6 p. MHC I surface protein 16. distal cis-element that recruits specific transcription factors 7 q. poly-ubiquitination 17. covalent linkage formed between two cysteines 12 r. signal recognition particle 18. Responsible for X chromosome inactivation 14 s. histone acetyl transferase 19. inhibition of gene expression by overexpressing transcription factor interacting proteins 3 t. kinase 20. structure that binds mRNA to initiate translation
Part II: Basic Problems
( 8 pts) 4. What is meant by a protein domain? Give an example. A protein domain is a region of a protein that, because of its shape and charge, has a unique FUNCTION, such as DNA binding, kinase activity, embedding into the plasma membrane, etc. ( 8 pts) 5. To what organelle do newly synthesized enzymes involved in degrading phagocytosed nutrients move to when they leave the trans Golgi network? How do the cells make sure the enzymes are directed specifically there? They are transported to the lysosome. This is done by tagging them with Mannose- 6 - phosphate, which is recognized by the M6P receptor on vesicles that travel from the TGN to the lysosomes and back.
( 18 pts) 7. There is a normal mRNA molecule floating in the cytoplasm (below). It’s going to be targeted by the small ribosomal subunit. The subunit will scan for a start codon (shown in bold) so it can begin the translation process. Another mRNA is identical, only the start codon has been accidentally mutated. Seeing the Mutant sequence below, do you think the ribosome will translate anything from the mutated mRNA? If so, who or why not? IF there is a protein translated from it and it has the wrong amino acid sequences, propose a detailed mechanism of how you could get rid of this protein. Wildtype (normal) 5’ ... CAGUCC AUG UUUCAGAUAGAGGGCUCAUGCCAUAUGGUGCUUAGGCAU ... 3’ Mutant 5’ ... CAGUCCACGUUUCAGAUAGAGGGCUCAUGCCAUAUGGUGCUUAGGCAU ... 3’ Yes, the ribosome small subunit will continue scanning the RNA passed the mutated start codon and find another AUG downstream (highlighted in red). It will then initiate translation starting with that AUG and procedure to translate the remaining mRNA strand into protein until it finds a stop codon. To get rid of this protein, the cell would use the poly-ubiquitination system for targeting to the proteasome. Students were expected to describe the E1-E2-E3 system for ubiquitin ligation. ( 18 pts) 8. Based on what you know about protein function, the forces that determine interactions, protein shape, and amino acid charge, list some characteristics about the membrane protein shown below. Name 3 amino acids you could plausibly find within each section of the protein that you listed. You may use the table below to explain your answer amino acid selection in each protein section. Tetramer complex This question was wide open to a number of answers. The protein above is a transmembrane protein. How would you design subunits that embed into the membrane? You would probably want to choose nonpolar amino acids (hydrophobic) to traverse the membrane. The inside of the channel seems to be exposed to water. So, that area may have been made with polar amino acids. The protein above is a tetramer. Therefore, you have 4 subunits that must bind together. How would you design subunits that bind together? You could use disulphide bonds from cysteins, positive/negative amino acid interactions or hydrophobic regions that would keep the subunits together. As a bonus, you could have mentioned that you need to have had an ER signal sequence, since this protein wound up at the membrane. There were many other examples of protein interactions and amino acids properties that you could have used. The above were just some examples.
Part IV: Extra Credit Problems
( 8 pts) 9. Based on what you know about targeting sequences and on the table below, name 3 amino acids you could plausibly expect to find within an ER signal targeting sequence. Explain your answer. The signal sequence is made up of hydrophobic amino acids. List some below.
