Docsity
Log inSign up
Docsity
Prepare for your exams
Prepare for your exams

Study with the several resources on Docsity

Earn points to download
Earn points to download

Earn points by helping other students or get them with a premium plan

Guidelines and tips
Guidelines and tips
Sell on Docsity
Sell on Docsity
Log inSign up

Prepare for your exams

Study with the several resources on Docsity

Find documents

Prepare for your exams with the study notes shared by other students like you on Docsity

Search Store documents

The best documents sold by students who completed their studies

Search through all study resources
Docsity AINEW

Summarize your documents, ask them questions, convert them into quizzes and concept maps

Explore questions

Clear up your doubts by reading the answers to questions asked by your fellow students

Earn points to download

Earn points by helping other students or get them with a premium plan

Share documents
download point icon20 Points

For each uploaded document

Answer questions
download point icon5 Points

For each given answer (max 1 per day)

All the ways to get free points
Get points immediately

Choose a premium plan with all the points you need

Study Opportunities

Choose your next study program

Get in touch with the best universities in the world. Search through thousands of universities and official partners

Community

Ask the community

Ask the community for help and clear up your study doubts

University Rankings

Discover the best universities in your country according to Docsity users

Free resources

Our save-the-student-ebooks!

Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors

From our blog

Exams and Study
Go to the blog

Final Exam 2008 | Molecular Biology | MICR 302, Exams of Molecular biology

Southern Illinois University (SIU) - CarbondaleMolecular biology

Material Type: Exam; Class: Molecular Biology; Subject: Microbiology; University: Southern Illinois University Carbondale; Term: Spring 2008;

Typology: Exams

2009/2010

Uploaded on 02/24/2010

koofers-user-3a7-2
koofers-user-3a7-2 🇺🇸

4

(1)

10 documents

1 / 16

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
MICR 302: Final Exam, 5 May 2008
Name:
Multiple Choice Questions (2 points each): Circle the letter next to the single best answer
1. Why is Caenorhabditis elegans used as a model for apoptosis and development?
a) It is a haploid eukaryote
b) It has only 2000 genes
c) It has a fixed number of cells, which can be tracked
d) It causes important diseases of livestock
e) It is potentially immortal unless consumed by a predator
2. The enzyme telomerase:
a) Breaks up the DNA in cells that are dying in order to recycle the components
b) Carries a segment of DNA that it adds to the ends of chromosomes
c) Shortens the ends of chromosomes in cells that have stopped dividing
d) Carries a segment of RNA that it uses to mend gaps in chromosomal DNA
e) Lengthens the telomeres in cells that continue replicating
3. Life expectancy correlates more with your mother’s than your father’s because:
a) Women have two X chromosomes and men have only one
b) Female steroid hormones prolong life length
c) Mitochondria are inherited maternally
d) The observed correlation is biased because paternity is not always known correctly
e) None of the above is the correct answer
4. Contact inhibition is seen when:
a) Normal cells form a monolayer
b) A bacterial toxin binds to the surface of an animal cell
c) Cancer cells form a micro-tumor in culture
d) The Ti plasmid is transferred into plants by Agrobacterium
e) A repressor binds to DNA
5. The eukaryotic cell cycle is regulated by:
a) Cyclin proteins that phosphorylate CDK proteins
b) Cyclic AMP activates cyclin dependent kinases
c) Cyclin proteins that activate cyclin dependent kinases
d) Cyclic AMP activates cyclin proteins
e) Cyclin dependent kinases that activate cyclins
6. Cancer is due to:
a) Programmed cell death triggered by carcinogens
b) Mutations in somatic cells that affect cell division
c) Mutations in germ line cells
d) Loss of oncogenes
e) Expression of viral reverse transcriptase
7. The average difference in DNA sequence between human and chimpanzee is approximately:
1
pf3
pf4
pf5
pf8
pf9
pfa
pfd
pfe
pff

Partial preview of the text

Download Final Exam 2008 | Molecular Biology | MICR 302 and more Exams Molecular biology in PDF only on Docsity!

MICR 302: Final Exam, 5 May 2008

Name: Multiple Choice Questions (2 points each): Circle the letter next to the single best answer

  1. Why is Caenorhabditis elegans used as a model for apoptosis and development? a) It is a haploid eukaryote b) It has only 2000 genes c) It has a fixed number of cells, which can be tracked d) It causes important diseases of livestock e) It is potentially immortal unless consumed by a predator
  2. The enzyme telomerase: a) Breaks up the DNA in cells that are dying in order to recycle the components b) Carries a segment of DNA that it adds to the ends of chromosomes c) Shortens the ends of chromosomes in cells that have stopped dividing d) Carries a segment of RNA that it uses to mend gaps in chromosomal DNA e) Lengthens the telomeres in cells that continue replicating
  3. Life expectancy correlates more with your mother’s than your father’s because: a) Women have two X chromosomes and men have only one b) Female steroid hormones prolong life length c) Mitochondria are inherited maternally d) The observed correlation is biased because paternity is not always known correctly e) None of the above is the correct answer
  4. Contact inhibition is seen when: a) Normal cells form a monolayer b) A bacterial toxin binds to the surface of an animal cell c) Cancer cells form a micro-tumor in culture d) The Ti plasmid is transferred into plants by Agrobacterium e) A repressor binds to DNA
  5. The eukaryotic cell cycle is regulated by: a) Cyclin proteins that phosphorylate CDK proteins b) Cyclic AMP activates cyclin dependent kinases c) Cyclin proteins that activate cyclin dependent kinases d) Cyclic AMP activates cyclin proteins e) Cyclin dependent kinases that activate cyclins
  6. Cancer is due to: a) Programmed cell death triggered by carcinogens b) Mutations in somatic cells that affect cell division c) Mutations in germ line cells d) Loss of oncogenes e) Expression of viral reverse transcriptase
  7. The average difference in DNA sequence between human and chimpanzee is approximately:

a) One base in 10 b) One base in 100 c) One base in 1, d) One base in 10,000 e) One base in 100,

  1. The p53 gene is involved in many human cancers because: a) It is present in the mitochondrial DNA b) A mutant copy of the gene is frequently inherited c) It is carried by a retrovirus d) The p53 protein forms tetramers when it binds DNA e) None of the above is correct
  2. Tumor suppressor genes: a) Usually have dominant mutations b) Often encode growth factors, hormones or their receptors c) Often encode DNA repair enzymes d) Generally act by suppressing cell division e) None of the above is correct
  3. Mutant Ras protein is hyperactive because: a) It is trapped in the nucleus b) It cannot split its bound GTP c) It can no longer bind to DNA d) It can no longer bind phosphate e) It is capable of forming tetramers
  4. Messenger RNA in a eukaryotic cell has attached to it: a) A tail of poly U at its 3' end b) A tail of poly A at its 5' end c) A cap of methylated adenine at its 5' end d) A cap of methylated guanine at its 5' end e) A ribosome binding site close to the 5' end
  5. Major differences between eukaryotes and prokaryotes include: a) Eukaryotes have multiple chromosomes and polycistronic mRNA b) Only prokaryotes have plasmids c) Eukaryotes have circular chromosomes inside a nucleus with a membrane d) Prokaryotes have multiple circular chromosomes and smaller ribosomes e) Eukaryotes have linear DNA and contain mitochondria
  6. Eukaryotes need telomerase because: a) Multiple chromosomes must be kept separate b) It switches off RNA synthesis in old cells c) It cuts open circular DNA and linearizes it d) RNA primers are used for replication of linear DNA e) To modify the ends of messenger RNA before it exits the nucleus
  7. Cancer caused by human papillomavirus is due to: a) Destruction of host pRB and p53 proteins b) Increase in level of host p53 protein c) Synthesis of cyclin proteins encoded by the virus d) Insertion of virus DNA into host chromosomes e) A cellular oncogene picked up and carried by the virus
  8. A defect in monoamine oxidase causes:

e) Viroids do not have coding sequences

  1. The term Prion refers to: a) A small protein that causes cancer in nerve cells b) A virus protein that damages brain cells c) Protein components of a virus coat d) An infectious protein that is encoded by the animal cell which it infects e) A protein that binds small RNA molecules involved in splicing
  2. The pathogenic form of the Prion differs from the normal form: a) By the addition of just one amino acid at the N-terminus b) By the addition of several amino acids at the C-terminus c) By having more beta sheet and less alpha helix d) By the attachment of lipid molecules e) By losing half a dozen amino acids from the N-terminus
  3. The largest known viruses: a) Have around 200-300 genes b) Only infect plant cells c) Have no protein coat, just a lipid envelope d) Contain both DNA and RNA e) Have more genes than some bacteria
  4. During rolling circle replication: a) Many interlocking circles of DNA are made b) Two different origins of replication are used c) Both strands of DNA are opened (“nicked”) when replication starts d) All of the new DNA is made as short Okazaki fragments e) None of the above is true
  5. A VNTR is a: a) Virus nuclease that destroys transcribed RNA b) Variable number of terminal repeats, and is found at the ends of chromosomes c) Cluster of tandem repeats that varies in number in different individuals d) Cluster of tandem repeats found in different places on the chromosomes of different individuals e) Virus non-transcribed region
  6. You receive a mysterious envelope containing a threatening message and extract DNA from the saliva used to stick the flap shut. Sequencing this should enable you to determine: a) The age of the sender b) Whether the sender was a vegetarian c) Whether the sender was an identical twin d) Whether a trained chimpanzee licked the envelope e) All of the above
  7. In the Southern Blotting procedure a) Labeled probe DNA is used to visualize target DNA bound to a membrane b) Labeled messenger RNA is used to visualize target DNA bound to a membrane

c) Bands of radioactively labeled RNA are separated by gel electrophoresis d) Single strand binding protein (SSB) is used to bind single stranded DNA to a membrane e) RNA primers are used to make many copies of DNA that is transferred to a membrane

  1. In the ABO blood system: a) There are four possible phenotypes b) Having Type AB provides resistance against infections that cause dehydration c) The alternative antigens are due to alternative splicing a) There are three possible phenotypes e) None of the above is correct
  2. In corn (maize), the Ds element: a) Can transpose only if the Ac element is also present b) Can transpose only if it is carried by an integrated virus c) Consists of dsRNA d) Always produces unstable mutations e) Is transmitted from cell to cell as a viroid
  3. One major reason why mitochondrial DNA is often used in the analysis of human ancestry is: a) It is circular b) It can replicate in bacteria c) It is inherited paternally d) It contains many useful inverted repeats e) Each cell contains multiple copies
  4. Modern humans are most likely derived from: a) African ancestors who lived about 100,000 years ago b) Asian ancestors who lived about 1,000,000 years ago c) Hybridization between Homo sapiens and Neanderthal man d) Multiple tribes who exchanges genes and co-evolved e) European ancestors who practiced cannibalism
  5. Male ancestry is traced by using: a) Mitochondrial DNA b) Any chromosome other than the X chromosome c) Genes on the Y chromosome d) Genes shared by the X chromosome and the Y chromosome e) Messenger RNA extracted from sperm
  6. Cloned mammals are never exact copies because: a) The nucleus that is donated often undergoes genetic rearrangements b) The egg cell that receives the nucleus retains one copy of the X chromosome c) They contain DNA segments from the X chromosome of the mother animal that gives birth to the new embryo d) The egg cell that receives the transplanted nucleus contains its own mitochondrial DNA e) External DNA is transformed in during the cloning procedure
  7. The insecticide proteins (Bt toxins) produced by Bacillus thuringiensis were improved for use in transgenic plants by the following: a) The introns were removed from the gene for Bt toxin

c) Protection against cancer d) Disposing of messenger RNA that is no longer needed after cellular differentiation e) Coordinating cell division

  1. RNAi does not get amplified or spread in mammals because: a) Mammals do not have the RISC complex b) Mammals do not have RNA-dependent RNA polymerase c) Mammals do not have cytoplasmic connections between the cells d) Mammals do not have Dicer e) RNAi does get amplified and spread in mammals, it is just difficult to detect
  2. The mechanism of riboswitch operation usually involves: a) Cleavage of RNA by a ribozyme b) Binding of folded RNA to regulatory sites on DNA c) Binding of folded RNA to regulatory proteins d) Binding of folded RNA to small signal molecules e) Removal of the polyA tail of messenger RNA
  3. Riboswitches are normally located: a) On ribosomal RNA b) At the 5’-ends of messenger RNA c) Between coding sequences on polycistronic messenger RNA d) On antisense RNA e) Between the coding sequence and polyA tail of messenger RNA
  4. RISC stands for: a) RNA Induced Silencing Complex b) RNA Interfering Slicing Complex c) RNA Interference Sensing Components d) RNA Interference and Silencing Components e) RNA Induced Sequence Comparison
  5. The most important difference between microRNA and siRNA is: a) miRNA causes destruction of its target, siRNA does not b) siRNA base-pairs completely with its target, miRNA does not c) siRNA stops transcription, miRNA blocks translation d) miRNA is generated by Dicer but siRNA is generated by Slicer e) None of the above is correct
  6. Self splicing introns: a) Rely on resolvase to remove them instead of the spliceosome b) Move from one messenger RNA to another c) Use the RISC complex to degrade the intron after excision d) Have an internal guide sequence that base pairs to the 5’ splice junction e) Have an active site made up of several hyperactive uracils
  7. In addition to colicin E1 the ColE1 plasmid codes for a protein that: a) Protects the DNA of the ColE1 plasmid by methylation

b) Provides immunity to all colicins of the E family c) Integrates the DNA of ColE1 plasmid into the bacterial chromosome d) Provides immunity to colicin E1 only e) Cuts the DNA of other colicin plasmids

  1. Most colicin proteins operate by one of two major mechanisms which are: a) Activation of adenylate cyclase or degradation of nucleic acids b) Creation of membrane pores or degradation of nucleic acids c) Creation of membrane pores or degradation of ribosomal proteins d) Activation of adenylate cyclase or degradation of ribosomal proteins e) Creation of membrane pores or activation of adenylate cyclase
  2. Retroviruses and retrotransposons both use: a) Reverse transcriptase to convert RNA to a DNA copy b) Reverse transcriptase to convert DNA to an RNA copy a) Reverse transposase to insert RNA into DNA a) Reverse transposase to move RNA segments between different RNA molecules a) Reverse transcriptase to generate RNA from inverted DNA repeats
  3. A pathogenicity island is: a) An isolated region of the world where novel viruses evolve in isolation b) A segment of a chromosome where virulence genes are clustered c) An intervening sequence in genes that regulate virulence d) A large plasmid found in bacteria causing severe disease e) A group of closely related bacteria that share virulence genes
  4. Yersinia pestis possesses: a) A lethal toxin that is released when bacteria are digested by white cells in the bloodstream b) Three plasmids that encode a variety of virulence factors c) The ability to enter mammalian cells and penetrate into the nucleus d) Several pathogenicity islands responsible for virulence e) A special system to inject toxins across the intestinal wall
  5. What is the function of the PA protein of anthrax toxin? a) It is attached by disulfide bonds to the LF and EF proteins b) It binds to receptors on the cell surface c) It activates the LF and EF proteins d) It destroys animal cell regulatory proteins e) It is a nuclease
  6. Antiviral drugs such as AZT a) Block the extension of DNA chains b) Prevents insertion of retrovirus DNA into host chromosomes c) Degrades viral RNA d) Inhibits the activity of reverse transcriptase e) Inhibits processing of viral proteins
  7. The retrovirus particle contains:
  1. (6 pts) List THREE things you could do to increase your life expectancy. (Your answers should be based in scientific reality!!)
  2. (8 pts) The diagram below represents a single PCR cycle. Answer the following: What does PCR stand for? ______________________________________________ The reagents are mixed during time period A. List the ingredients that are included in a typical PCR reaction: 1. _______________________ 2. ________________________
    1. _______________________ 4. ________________________ What happens during each of the following time periods: B _______________________________________ C _______________________________________ D _______________________________________
  3. (6 pts) List THREE examples of ribozymes or structures that contain ribozymes. Explain very briefly what each ribozyme does.

_________________________________________________________________

2. _____________________________________________________________

_________________________________________________________________

3. _____________________________________________________________

_________________________________________________________________

Dr. Kelly Bender’s Questions Multiple Choice Questions (2 points each): Circle the letter next to the single best answer

  1. Which of the replication forks below is correct AND what is the name of the enzyme that fills in the gaps between the Okazaki fragments? A) Fork 1 and DNA Polymerase I B) Fork 1 and DNA Polymerase II C) Fork 2 and DNA Polymerase II D) Fork 1 and DNA Polymerase III E) Fork 2 and DNA Polymerase III
  2. Below is a diagram of a 8 kb linear piece of DNA with a single restriction site denoted by an “X”. Which of the lanes on the gel diagram below depicts the banding pattern of this fragment following restriction digestion? On the gel electrophoresis diagram the rectangles are indicative of the wells in which DNA samples have been loaded, while the “+” and “-“ indicate the location of the corresponding electrodes. Molecular weights of the bands are indicated in kilobases. A) lane a B) lane b C) lane c D) lane d E) None of the above 11 helicase 5 ’ 3 ’ 3 ’ 5 ’ helicase 5 ’ 3 ’ 3 ’ 5 ’ Fork 1 Fork 2 a b c d

2---

6---

6---

2---

2---

6---

6---

2---

8 kb dsDNA

  1. Which one of the following is the first step in translation initiation? A) Initiation factors bind to the ribosome binding site B) 23S rRNA associated with the 50S ribosomal subunit binds to the ribosome binding site C) 16S rRNA associated with the 30S ribosomal subunit binds to the ribosome binding site D) Initiator f-Met tRNA binds to the ribosome binding site E) Initiator f-Met tRNA binds to the first AUG
  2. Which of the following statements is FALSE regarding translation elongation? A) The incoming tRNA enters the A-site B) The growing peptide chain is attached to the tRNA in the E-site C) Sliding of the ribosome towards the 3’ end of the mRNA is called translocation D) Peptidyl transferase links amino acids E) Elongation is monitored by proteins called elongation factors
  3. Which of the following is an example of post-translation regulation? A) Fe binding to Fur B) Maltose binding to MalT C) cAMP binding to CRP D) Lactose binding to LacI E) All of the above
  4. How many amino acids would the open reading frame below encode? The “R” indicates the region where the ribosome would bind.

A) 4 5’ GGTACATGCGTGACGTTTGAATTACTTAG 3’

B) 5 3’ CCATGTACGCACTGCAAACTTAATGAATC 5’

C) 6

D) 8

E) 9

  1. During conjugation between a donor cell with the F plasmid and a recipient cell without a F plasmid, which of the following statements is/are FALSE? A) Double stranded DNA enters the cell via the conjugation bridge B) The F DNA is nicked by a nuclease at the ori V. C) Single stranded DNA enters the cell via the sex pilus D) A and B E) All of the above
  2. Which of the events below would NOT require recombination to change the genotype of the recipient? A) Transfer of a random piece of bacterial DNA during generalized transduction. B) Transformation with a linear piece of DNA. C) Hfr transfer where the recipient stays F minus. D) Transformation with an R-plasmid E) All of the above
  3. During specialized transduction which of the following statements is/are TRUE? A) Lambda phage randomly package DNA from the bacterial host B) Transducing particles contain a mixture of viral and bacterial chromosomal DNA

R

C) P1 phage DNA is inserted into the att  site of the bacterial chromosome D) Both A and B E) All of the above

  1. Which of the statements below regarding restriction enzymes is/are FALSE? A) Restriction enzymes are thought to be a defense mechanism against viruses B) Enzymes yielding sticky ends are more desirable than those that yield blunt ends C) Modification enzymes protect the host DNA from degradation D) Type I enzymes cut in the middle of the recognition sequence E) All of the above
  2. During a standard cloning reaction using a vector that allows for blue/white selection, ten blue colonies were obtained on media containing both ampicillin and X-gal. What do these results mean? A) All of the colonies contain the plasmid B) None of the colonies contain recombinant vectors C) All of the colonies contain recombinant vectors D) Both A and B E) None of the above
  3. If the human insulin gene was cloned into bacteria without any manipulation, what would be the expressed product? A) Preproinsulin B) Proinsulin C) Insulin A and B D) Only the alpha chain E) Only the beta chain
  4. Which of the statements below describes problem(s) associated with successfully cloning and expressing genes from one organism into a different organism? A) Promoter recognition B) Terminator recognition C) Codon frequency D) Protein processing E) All of the above
  5. Which of the following statements is FALSE regarding DNA replication? A) DNA Polymerase I possesses 5'  3' polymerase activity B) DNA Polymerase I possesses 5'  3' exonuclease activity C) PriA removes the Single Stranded Binding (SSB) proteins D) Primase seals the nicks between nucleotides on the lagging strand E) Gyrase relieves supercoiling
  6. During transcription what role does the sigma subunit of RNA polymerase have? A) Adds ribonucleotides complementary to the coding strand B) Adds ribonucleotides complementary to the template strand C) Transcribes the promoter region of a gene D) Binds to the operator and recruits the core subunit E) Binds to the promoter sequence and recruits the core subunit
  7. Which one of the following is NOT a characteristic of a transcriptional terminator sequence? A) Contains inverted repeats

OH OH OH OH OH OH