Docsity
Log inSign up
Docsity
Prepare for your exams
Prepare for your exams

Study with the several resources on Docsity

Earn points to download
Earn points to download

Earn points by helping other students or get them with a premium plan

Guidelines and tips
Guidelines and tips
Sell on Docsity
Sell on Docsity
Log inSign up

Prepare for your exams

Study with the several resources on Docsity

Find documents

Prepare for your exams with the study notes shared by other students like you on Docsity

Search Store documents

The best documents sold by students who completed their studies

Search through all study resources
Docsity AINEW

Summarize your documents, ask them questions, convert them into quizzes and concept maps

Explore questions

Clear up your doubts by reading the answers to questions asked by your fellow students

Earn points to download

Earn points by helping other students or get them with a premium plan

Share documents
download point icon20 Points

For each uploaded document

Answer questions
download point icon5 Points

For each given answer (max 1 per day)

All the ways to get free points
Get points immediately

Choose a premium plan with all the points you need

Study Opportunities

Choose your next study program

Get in touch with the best universities in the world. Search through thousands of universities and official partners

Community

Ask the community

Ask the community for help and clear up your study doubts

University Rankings

Discover the best universities in your country according to Docsity users

Free resources

Our save-the-student-ebooks!

Download our free guides on studying techniques, anxiety management strategies, and thesis advice from Docsity tutors

From our blog

Exams and Study
Go to the blog

Exam 1 for Bacterial and Viral Genetics | MICR 460, Exams of Bacteriology

Southern Illinois University (SIU) - CarbondaleBacteriology
Prof. Kelly S. Bender

Material Type: Exam; Professor: Bender; Class: Bacterial & Viral Genetics; Subject: Microbiology; University: Southern Illinois University Carbondale; Term: Unknown 2007;

Typology: Exams

2009/2010

Uploaded on 02/24/2010

koofers-user-djs
koofers-user-djs 🇺🇸

5

(2)

10 documents

1 / 6

Toggle sidebar

This page cannot be seen from the preview

Don't miss anything!

bg1
1
NAME: __________________________
MICR/MBMB 460: First Hourly Exam - 2007
The following abbreviations are used in this exam: DNAP = DNA polymerase; ORF = open reading frame;
P = promoter; t = terminator.
1. (8 pts) Draw a DNA strand of three nucleotides. Indicate the position of the nitrogenous
base with an "N" (there's no need to draw the base) and the phosphate with a "P" (no need to
draw the oxygens). Number the carbons on one of the nucleotides. With an arrow, indicate the
exact bond that would be broken by a 3'>5' exonuclease.
2. (8 pts) From the following graphic:
a) Label the transcribed spacer(s) with an 'A'.
b) Draw a BOX around each transcriptional unit.
c) Draw a CIRCLE around each gene.
d) Indicate where the ribosome binding site(s) should be with an 'X'.
3. (2 pts) DRAW the reason why it is not necessary that RNAP be able to proofread.
P Pt t
ORF 1 ORF 216S rRNA tRNAVal 23S rRNA
pf3
pf4
pf5

Partial preview of the text

Download Exam 1 for Bacterial and Viral Genetics | MICR 460 and more Exams Bacteriology in PDF only on Docsity!

NAME: __________________________

MICR/MBMB 460: First Hourly Exam - 2007 The following abbreviations are used in this exam: DNAP = DNA polymerase; ORF = open reading frame; P = promoter; t = terminator.

1. (8 pts) Draw a DNA strand of three nucleotides. Indicate the position of the nitrogenous base with an "N" (there's no need to draw the base) and the phosphate with a "P" (no need to draw the oxygens). Number the carbons on one of the nucleotides. With an arrow, indicate the exact bond that would be broken by a 3'>5' exonuclease. 2. (8 pts) From the following graphic: a) Label the transcribed spacer(s) with an 'A'. b) Draw a BOX around each transcriptional unit. c) Draw a CIRCLE around each gene. d) Indicate where the ribosome binding site(s) should be with an 'X'. 3. (2 pts) DRAW the reason why it is not necessary that RNAP be able to proofread. P t P t 16S rRNA tRNAVal^ 23S rRNA ORF 1 ORF 2

4. (6 pts) a) Describe the phenotype (in brief phrases) of an E. coli strain that has the following genotype: tyrA, bla, malD. b) Would this organism form colonies on the following plates? (Just yes or no for each) Minimal media (no amino acids) + glucose Minimal media (no amino acids) + maltose (no glucose) + tyrosine Minimal media (no amino acids) + glucose + tyrosine 5. (2 pts) In the graphic below, DRAW the charged and uncharged (empty) tRNAs as they would appear in the ribosome IMMEDIATELY BEFORE translocation took place. 6. (2 pts) Name ONE of potentially three parts of a transcriptional unit that is transcribed but not translated. 7. (2 pts) DRAW the fate of a protein produced through the action of tmRNA.

12. (8 pts) In a maximum of five complete sentences, explain why UV light is mutagenic. In your answer, you must include SOS, RecA, LexA, DNAP IV and DNAP V. 13. (14 pts) You suspect a section of DNA you recently sequenced is a gene because it contains an ORF (open reading frame). The sequence upstream of the ORF is: GAATTACGACGCTATAATCGAACGGAGCCGAGAAG The sequence downstream of the ORF is: GGCTATAATCAGGCATCCCATAGGGATGCCAACCACA a) CIRCLE the putative - 10 region of the promoter. b) What specifically happens at the - 10 region during transcription? (5 words maximum) c) Put a BOX around the putative terminator region. d) (Circle the correct answer) This is likely a rho dependent / rho independent terminator. e) How would you identify an ORF? (One sentence only) f) Give the sequences of the stop codons.

14. (10 pts) a) BRIEFLY (1-2 sentences) describe one of the experiments described by Cairns that demonstrated selection-directed mutagenesis. b) What would the results have been if ALL mutations were random in space and time? c) DRAW the Wright theory discussed in class (hint: involves a transcription bubble) that explains how selection-directed mutations arise. You may use labels to describe your drawing. 15. (2 pts) As discussed in class, none of the Cairns' experiments involved antibiotic sensitivity/resistance. In one sentence, explain why.